Stem-loop sequence atr-MIR8613

AccessionMI0027503 (change log)
DescriptionAmborella trichopoda miR8613 stem-loop
Stem-loop
   auc     au           ca  u     uc  u           u       c            aug            au au      a     --      uc      -----       uca     cg    u  c      a            ca       a ug -aa ug           ca    caaaag        uau   cua g 
5'    uauaa  agaucauuuau  uu guaua  ga guuauaauuau cuugucc uuaaauuucaaa   ggugguuguaag  u  cauuga uagac  aaaguu  aaaaaa     aaaaauu   gacuu  ugac ca cucaag uauccaauuuga  ucuaaug g  g   a  auuaugaccuc  ugua      augaggau   aug   g a
      |||||  |||||||||||  || |||||  || ||||||||||| ||||||| ||||||||||||   ||||||||||||  |  |||||| |||||  ||||||  ||||||     |||||||   |||||  |||| || |||||| ||||||||||||  ||||||| |  |   |  |||||||||||  ||||      ||||||||   |||   |  
3'    auguu  ucuaguaaaug  aa uaugu  uu caguguuagua gaacagg aguuuaaaguuu   cuaccaacauuu  a  guaacu auuug  uuucaa  uuuuuu     uuuuuag   uugaa  acug gu ggguuc guagguuaaacu  agauuac c  u   u  uaauauuggag  auau      uauuucua   uac   c g
   uau     gu           aa  u     uc  u           c       u            aua            au cg      g     ag      --      auuaa       uac     au    u  a      a            ac       - gu cac gu           ua    ------        -uu   --- a 
Get sequence
Deep sequencing
2133 reads, 8.18e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 3482754-3483188 [+]
intergenic
Database links

Mature sequence atr-miR8613

Accession MIMAT0033905
Sequence

271 - 

caucaaauuggaugacuugggaug

 - 294

Get sequence
Deep sequencing1451 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).