Stem-loop sequence atr-MIR8614

AccessionMI0027504 (change log)
DescriptionAmborella trichopoda miR8614 stem-loop
Stem-loop
   uauaca       c     c    g      u              ca             u   u   g     u    ga   aucauuguuugggcaccaagucc 
5'       augagac auuua uuuu auacaa gaggucacaaucau  uuggcuguuggau uga auc ggugg ugag  ugu                       a
         ||||||| ||||| |||| |||||| ||||||||||||||  ||||||||||||| ||| ||| ||||| ||||  |||                        
3'       uacucug uaaau aaaa uauguu cuccaguguuagug  aaucgauaaccug acu uag uuauc auuu  acg                       a
   auauca       a     a    a      c              -a             u   u   g     u    uc   cuguguuguuaacucuuuacaaa 
Get sequence
Deep sequencing
1021 reads, 4.5e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00007: 6003383-6003599 [+]
intergenic
Database links

Mature sequence atr-miR8614

Accession MIMAT0033906
Sequence

161 - 

caauagcuaaagugauugugacc

 - 183

Get sequence
Deep sequencing334 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).