Stem-loop sequence atr-MIR156a

AccessionMI0027505 (change log)
DescriptionAmborella trichopoda miR156a stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
         ---u      gag    u     auag   ga  -   uc     -----u  u         -a             --      c      ug 
5' aggguu    auaugu   ggag aagua    aga  gg ggg  uggug      ug ugacagaag  uagagagcacaua  aaguaa gugcag  g
   ||||||    ||||||   |||| |||||    |||  || |||  |||||      || |||||||||  |||||||||||||  |||||| ||||||  g
3' uccuaa    uauaca   ccuc uucau    ucu  cc ccc  accac      ac acugucuuc  aucucucguguau  uuuauu uacguu  c
         ucuu      --a    -     ----   ac  a   uu     ucgucc  u         cg             gu      u      ug 
Get sequence
Deep sequencing
3220 reads, 2.05e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00044: 4041291-4041476 [+]
intergenic
Database links

Mature sequence atr-miR156a

Accession MIMAT0033907
Sequence

51 - 

uugacagaagauagagagcac

 - 71

Get sequence
Deep sequencing3213 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).