Stem-loop sequence atr-MIR156b

AccessionMI0027506 (change log)
DescriptionAmborella trichopoda miR156b stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   uggugauagugcacguaaggua       u  guaugauagagaagag           -             a      cu   uu   c    
5'                       uguuggu gu                gaggugacaga agagagugagcac uauggc  uuc  gca cga 
                         ||||||| ||                ||||||||||| ||||||||||||| ||||||  |||  ||| || g
3'                       acaacca cg                cuucacugucu ucuuucauucgug guauug  aag  cgu gcu 
   ---------gccacuacacacc       c  ----------------           a             c      --   uu   a    
Get sequence
Deep sequencing
623 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00052: 3292164-3292324 [-]
intergenic
Database links

Mature sequence atr-miR156b

Accession MIMAT0033908
Sequence

53 - 

ugacagaagagagugagcac

 - 72

Get sequence
Deep sequencing599 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).