Stem-loop sequence atr-MIR156c

AccessionMI0027507 (change log)
DescriptionAmborella trichopoda miR156c stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   gau   --c        u   --cu  a         --------u   -  u  a      -            aaa  aa  c     auag 
5'    gag   aggggaga gag    ug aaguagagu         ggu ug ug cagaag auagagagcaca   cc  ca aagca    g
      |||   |||||||| |||    || |||||||||         ||| || || |||||| ||||||||||||   ||  || |||||    c
3'    cuc   ucccuucu cuc    au uuuaucuca         ccg ac ac gucuuc uaucucucgugu   gg  gu uucgu    u
   -cu   ccu        -   ccuu  c         cgaagauuc   u  c  c      a            aua  ag  c     acuu 
Get sequence
Deep sequencing
3222 reads, 2.52e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00061: 4133431-4133605 [+]
intergenic
Database links

Mature sequence atr-miR156c

Accession MIMAT0033909
Sequence

40 - 

uugacagaagauagagagcac

 - 60

Get sequence
Deep sequencing3210 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).