Stem-loop sequence atr-MIR156d

AccessionMI0027508 (change log)
DescriptionAmborella trichopoda miR156d stem-loop
Gene family MIPF0000008; MIR156
Stem-loop
   agagccuuugaagcuuucucucucuaacaauuugc    aga    g         uu  ------       -      -         a     c  auu     a 
5'                                    ggua   aagg gguaguggg  au      gcugaca gaagag agugagcac caugg ca   guaua c
                                      ||||   |||| |||||||||  ||      ||||||| |||||| ||||||||| ||||| ||   |||||  
3'                                    ccgu   uuuc uuaucgccc  ua      cgacugu cuucuc ucacucgug guguc gu   cguau c
   -----------ucuugccucuuacguccuccagua    --g    g         uu  cuauuu       u      c         c     u  cgc     g 
Get sequence
Deep sequencing
638 reads, 1.2e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00065: 3401522-3401718 [-]
intergenic
Database links

Mature sequence atr-miR156d

Accession MIMAT0033910
Sequence

63 - 

ugacagaagagagugagcac

 - 82

Get sequence
Deep sequencing623 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).