Stem-loop sequence atr-MIR159

AccessionMI0027509 (change log)
DescriptionAmborella trichopoda miR159 stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
   u  uau   u  uuu      uu      --------------ugu   uu    -u    uu uug              ga       u c   -u      uu      -  -      g  a u     g uc       gu        aauau 
5'  uc   gag ug   agauug  ggguug                 gua  uuug  aggg  g   acauggagcuccuu  gguccaa c agg  ucuuac  agguaa aa gcagcu cu g ucaug a  ccacugu  uauuucca     a
    ||   ||| ||   ||||||  ||||||                 |||  ||||  ||||  |   ||||||||||||||  ||||||| | |||  ||||||  |||||| || |||||| || | ||||| |  |||||||  ||||||||      
3'  ag   uuu ac   ucuagu  cccgau                 uau  gaac  uccc  c   uguaucucgaggga  uuagguu g ucc  agagug  uccguu uu cgucga ga c aguac u  gguggua  auagaggu     a
   a  -uu   u  uuu      -u      uuauuuacucucucuuu   uc    cu    cu uug              ag       u u   uu      -u      c  a      g  a c     g uu       au        aagag 
Get sequence
Deep sequencing
142868 reads, 5.6e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00105: 1236832-1237130 [-]
intergenic
Database links

Mature sequence atr-miR159

Accession MIMAT0033911
Sequence

211 - 

uuuggauugaagggagcucua

 - 231

Get sequence
Deep sequencing141527 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).