Stem-loop sequence atr-MIR160

AccessionMI0027510 (change log)
DescriptionAmborella trichopoda miR160 stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
   u u     ----uuuu         -c     g  aaagguaaau    --u     c       c              ua   u  a   uga 
5'  g gaugg        uuggagaga  aaggu ga          gggg   uaugc uggcucc uguaugccacucuu  gag cc auc   g
    | |||||        |||||||||  ||||| ||          ||||   ||||| ||||||| ||||||||||||||  ||| || |||    
3'  c cuauc        gaucucucu  uucua cu          cucu   auacg accgagg gcgugcggugggag  cuc gg uag   g
   a u     ucucuaau         cu     g  aacgaucucu    uuc     a       a              ua   -  c   ucg 
Get sequence
Deep sequencing
599 reads, 1.58e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00092: 1776607-1776790 [-]
intergenic
Database links

Mature sequence atr-miR160

Accession MIMAT0033912
Sequence

48 - 

ugccuggcucccuguaugcca

 - 68

Get sequence
Deep sequencing536 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).