Stem-loop sequence atr-MIR166c

AccessionMI0027515 (change log)
DescriptionAmborella trichopoda miR166c stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
      gau  -u     uauau  aua  a    u        uu      cu      a          -uau u 
5' uca   ga  gauga     gc   ug guug ggggaaug  gucugg  cgaggu caucuggggu    c u
   |||   ||  |||||     ||   || |||| ||||||||  ||||||  |||||| ||||||||||    |  
3' agu   cu  cuacu     cg   ac caac ccccuuac  cggacc  gcucua guagaccuua    g g
      auu  uc     cgagc  --a  -    u        uu      ag      -          cacu a 
Get sequence
Deep sequencing
581220 reads, 1.59e+05 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00128: 402019-402162 [-]
intergenic
Clustered miRNAs
< 10kb from atr-MIR166c
atr-MIR166dscaffold00128: 402266-402370 [-]
atr-MIR166cscaffold00128: 402019-402162 [-]
Database links

Mature sequence atr-miR166c

Accession MIMAT0033917
Sequence

94 - 

ucggaccaggcuucauucccc

 - 114

Get sequence
Deep sequencing579920 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).