Stem-loop sequence atr-MIR166d

AccessionMI0027516 (change log)
DescriptionAmborella trichopoda miR166d stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
   -ug   u        uu g    cu   g c      auuua   --aa    - u 
5'    uug ggggaaug  g cugg  cga g cauccg     gga    gccg c u
      ||| ||||||||  | ||||  ||| | ||||||     |||    |||| |  
3'    aac ccccuuac  c gacc  gcu c gugggc     ccu    cggu g c
   aca   u        uu g    ag   a a      -----   gaua    u g 
Get sequence
Deep sequencing
300833 reads, 8.33e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00128: 402266-402370 [-]
intergenic
Clustered miRNAs
< 10kb from atr-MIR166d
atr-MIR166dscaffold00128: 402266-402370 [-]
atr-MIR166cscaffold00128: 402019-402162 [-]
Database links

Mature sequence atr-miR166d

Accession MIMAT0033918
Sequence

78 - 

ucggaccaggcuucauucccc

 - 98

Get sequence
Deep sequencing299789 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).