Stem-loop sequence atr-MIR167

AccessionMI0027517 (change log)
DescriptionAmborella trichopoda miR167 stem-loop
Gene family MIPF0000023; MIR167_1
Stem-loop
   ---------aaguuuguuucuuucucucucuaaagauu  ug  c     g  u         ca            cccucc    aa 
5'                                       ug  ag aucag gg ugaagcugc  gcaugaucugau      ucua  a
                                         ||  || ||||| || |||||||||  ||||||||||||      ||||   
3'                                       ac  uc ugguc cc acuuugacg  cguacuagacua      agau  c
   uuggaacaucgaaagaguccccaauacuccucuauguc  gu  u     g  u         ag            -----a    cc 
Get sequence
Deep sequencing
11298 reads, 6.8e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00002: 9895576-9895741 [-]
intergenic
Database links

Mature sequence atr-miR167

Accession MIMAT0033919
Sequence

46 - 

ugaagcugccagcaugaucug

 - 66

Get sequence
Deep sequencing11231 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).