Stem-loop sequence atr-MIR169a

AccessionMI0027519 (change log)
DescriptionAmborella trichopoda miR169a stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
      a  a    aa       u    u  -u a          u    u     cauccacaauguggaugguucuagggugcua 
5' ggu ua caug  gagacag guua uu  g uagccaagga gacu gccua                               u
   ||| || ||||  ||||||| |||| ||  | |||||||||| |||| |||||                                
3' cca au guau  uucuguc cagu ag  c aucgguuccu cugg cggau                               g
      g  c    -c       c    c  uc a          -    -     cuuuggaguauuacucccagaauuaaccccg 
Get sequence
Deep sequencing
297 reads, 150 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00016: 2808583-2808748 [-]
intergenic
Database links

Mature sequence atr-miR169a

Accession MIMAT0033921
Sequence

32 - 

uagccaaggaugacuugccu

 - 51

Get sequence
Deep sequencing229 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).