Stem-loop sequence atr-MIR169b

AccessionMI0027520 (change log)
DescriptionAmborella trichopoda miR169b stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
   ugagcuaagggcac     u   --    c     ga    u    u  g  a    -        a        - uuu  u   aa  u   a     uga 
5'               agaag aga  gccu acaug  gggg gcaa gu cu gggu agccaagg ugacuugc c   ga cac  ug gug gagag   a
                 ||||| |||  |||| |||||  |||| |||| || || |||| |||||||| |||||||| |   || |||  || ||| |||||    
3'               ucuuc ucu  cgga uguac  ucuc cguu ua ga ucca ucgguucc gcugaacg g   uu gug  ac cac cucuu   a
   --------acuuau     -   uc    u     --    -    c  g  a    a        -        a uau  c   --  -   -     ggu 
Get sequence
Deep sequencing
129 reads, 150 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00057: 2389278-2389464 [-]
intergenic
Clustered miRNAs
< 10kb from atr-MIR169b
atr-MIR169cscaffold00057: 2391549-2391730 [+]
atr-MIR169bscaffold00057: 2389278-2389464 [-]
Database links

Mature sequence atr-miR169b

Accession MIMAT0033922
Sequence

125 - 

agcaagucgccuuggcuaacc

 - 145

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).