Stem-loop sequence atr-MIR169c

AccessionMI0027521 (change log)
DescriptionAmborella trichopoda miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Stem-loop
   uca     g    aaag    c      a   a       cuuuuu           u    ug cuaugcucucaagcauaagagagcuu 
5'    augag aggc    gucu acauga ggg uggggca      guagccaagga gacu  c                          a
      ||||| ||||    |||| |||||| ||| |||||||      ||||||||||| ||||  |                          c
3'    uacuu ucug    cgga uguacu ccc acuucgu      caucgguuccu cuga  g                          u
   -ag     -    aaca    c      c   -       auuauu           u    gu aaucuuugacuucuuaugguuuuccu 
Get sequence
Deep sequencing
227 reads, 125 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00057: 2391549-2391730 [+]
intergenic
Clustered miRNAs
< 10kb from atr-MIR169c
atr-MIR169bscaffold00057: 2389278-2389464 [-]
atr-MIR169cscaffold00057: 2391549-2391730 [+]
Database links

Mature sequence atr-miR169c

Accession MIMAT0033923
Sequence

48 - 

uagccaaggaugacuugccu

 - 67

Get sequence
Deep sequencing225 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).