Stem-loop sequence atr-MIR171a

AccessionMI0027522 (change log)
DescriptionAmborella trichopoda miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
        gucuuuu     cau   a     ua    c        a -             aa    u      aa 
5' agagg       ggaua   uga ggagu  uuug gauguugg c cgguucaaucaga  acac gcccag  a
   |||||       |||||   ||| |||||  |||| |||||||| | |||||||||||||  |||| ||||||   
3' ucucu       ucugu   acu cuucg  agac cuauaacc g gccgaguuaguuu  ugug uggguc  u
        -aucuuu     ucu   -     --    c        - c             cg    c      gu 
Get sequence
Deep sequencing
5393 reads, 3.62e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00001: 2643225-2643370 [-]
intergenic
Database links

Mature sequence atr-miR171a

Accession MIMAT0033924
Sequence

94 - 

ugauugagccgcgccaauauc

 - 114

Get sequence
Deep sequencing5037 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).