Stem-loop sequence atr-MIR171b

AccessionMI0027523 (change log)
DescriptionAmborella trichopoda miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   g   u    uu  uuuucau       a  -c          c      -----------c   c                    ug  ug   cc    ua 
5'  gua gaag  gg       gggagga gg  gaaggggacu gguucg            gug gguguuggcacgguucaauc  ac  cug  cugc  g
    ||| ||||  ||       ||||||| ||  |||||||||| ||||||            ||| ||||||||||||||||||||  ||  |||  ||||  u
3'  uau cuuc  cc       uccuccu cc  cuucuucuga cuaagc            cac cuauaaccgugccgaguuag  ug  ggu  gacg  u
   u   u    -u  ----uuc       -  uu          a      uaccgacuaacu   a                    cg  gu   au    ug 
Get sequence
Deep sequencing
740 reads, 4.6e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00060: 3430268-3430456 [+]
intergenic
Database links

Mature sequence atr-miR171b

Accession MIMAT0033925
Sequence

113 - 

uugagccgugccaauaucaca

 - 133

Get sequence
Deep sequencing564 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).