Stem-loop sequence atr-MIR171c

AccessionMI0027524 (change log)
DescriptionAmborella trichopoda miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
        a         gc  c      c              a   aaau      g --a g 
5' auuga ggaguucuu  ga auuggc cgguucgaucagag uga    gccaag a   a a
   ||||| |||||||||  || |||||| |||||||||||||| |||    |||||| |   |  
3' uaacu cuucgagaa  cu uaaccg gccgaguuagucuc auu    ugguuu u   u a
        -         -a  a      c              -   ----      g agg a 
Get sequence
Deep sequencing
3405 reads, 4.12e+03 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00088: 670603-670719 [-]
intergenic
Database links

Mature sequence atr-miR171c

Accession MIMAT0033926
Sequence

82 - 

ugauugagccgcgccaauauc

 - 102

Get sequence
Deep sequencing3201 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).