Stem-loop sequence atr-MIR172

AccessionMI0027525 (change log)
DescriptionAmborella trichopoda miR172 stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention atr-MIR172
(1 sentences)

Stem-loop
   --------------------guuguuuguuuga    ---u     a aagagagagaaaagaagaaaaaa  g   ga  a    g   uc     g gu                          a        ---a  aga      --       gugg    acacuuc 
5'                                  ugca    ggggu g                       ga gag  gg ggag aua  aguca u  uugcugguguagcaucaucaagauuc caucuugu    ag   ucccuu  ugaaucg    gauc       a
                                    ||||    ||||| |                       || |||  || |||| |||  ||||| |  |||||||||||||||||||||||||| ||||||||    ||   ||||||  |||||||    ||||        
3'                                  acgu    uccca c                       uu cuu  cc cuuu ugu  ucagu a  aacggcuacgucguaguaguucuaag guagaaua    uc   agggag  auuuagc    cuag       c
   caggagacaaagagaguggaaacggcuccucuc    uuac     c ----------------------g  g   -g  a    g   -u     g au                          g        ccag  gaa      ag       ---a    aauacau 
Get sequence
Deep sequencing
1210 reads, 2.26e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00012: 6005508-6005804 [+]
intergenic
Database links

Mature sequence atr-miR172

Accession MIMAT0033927
Sequence

194 - 

ggaaucuugaugaugcugca

 - 213

Get sequence
Deep sequencing102 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).