Stem-loop sequence atr-MIR319a

AccessionMI0027526 (change log)
DescriptionAmborella trichopoda miR319a stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
                        ccu     -u   gucu      c   --      g   ac        ucaaa   uu      a   ccgu 
5' gagggagcucucuuuagucca   auggu  ggu    aggggu gaa  uuaucu ccg  ucauucau     uaa  gguaga agg    g
   |||||||||||||||||||||   |||||  |||    |||||| |||  |||||| |||  ||||||||     |||  |||||| |||     
3' cucccucgagggaagucaggu   uacca  ccg    uuccca cuu  aauaga ggc  aguaagug     auu  ucaucu ucu    a
                        ucu     cu   ----      -   ua      g   gu        uuuaa   uc      c   uuuu 
Get sequence
Deep sequencing
36933 reads, 1.07e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00077: 2616711-2616892 [+]
intergenic
Database links

Mature sequence atr-miR319a

Accession MIMAT0033928
Sequence

161 - 

uuggacugaagggagcuccc

 - 180

Get sequence
Deep sequencing36866 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).