Stem-loop sequence atr-MIR319b

AccessionMI0027527 (change log)
DescriptionAmborella trichopoda miR319b stem-loop
Gene family MIPF0001104; MIR319
Stem-loop
        uu c    a             g  ga     -aaa  -a    ------   uca 
5' gaaaa  g agaa ugggggcuccuuu ag  caaag    gc  uuuc      gga   u
   |||||  | |||| ||||||||||||| ||  |||||    ||  ||||      |||    
3' cuuuu  c ucuu auccucgagggaa uc  guuuc    cg  gaag      ucu   c
        cu u    a             g  ag     cuac  ac    ugacuc   uuu 
Get sequence
Deep sequencing
47360 reads, 1.63e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00081: 2902538-2902653 [+]
intergenic
Database links

Mature sequence atr-miR319b

Accession MIMAT0033929
Sequence

81 - 

uuuggacugaagggagcuccu

 - 101

Get sequence
Deep sequencing47357 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).