Stem-loop sequence atr-MIR319c

AccessionMI0027528 (change log)
DescriptionAmborella trichopoda miR319c stem-loop
Gene family MIPF0000010; MIR159
Stem-loop
     a                   uc     u  cagu       a  gcu   g   g  c     c      u       a     guu 
5' ga ggagcucucuucaguccag  uagga gg    ucgaucg au   gcu ccg gu cuucu uuauaa gccuuug uuuuu   u
   || |||||||||||||||||||  ||||| ||    ||||||| ||   ||| ||| || ||||| |||||| ||||||| |||||    
3' cu ccucgagggaagucagguu  guucu cc    aguuggu ua   cga ggc ca gaaga aguguu cggaagc aagga   g
     c                   cc     u  --cc       c  agu   g   g  u     u      u       a     aaa 
Get sequence
Deep sequencing
36670 reads, 1.1e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00105: 1160459-1160636 [+]
intergenic
Database links

Mature sequence atr-miR319c

Accession MIMAT0033930
Sequence

157 - 

uuggacugaagggagcuccc

 - 176

Get sequence
Deep sequencing36639 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).