Stem-loop sequence atr-MIR319e

AccessionMI0027530 (change log)
DescriptionAmborella trichopoda miR319e stem-loop
Gene family MIPF0001104; MIR319
Stem-loop
      ucuucaa        -   a   gcaaaaa             g  ga    gaaagcacuuu    c u      gc 
5' gag       guaaaaag gaa aau       ugggagcuccuuu ag  caaa           ggau g cuuuuu  u
   |||       |||||||| ||| |||       ||||||||||||| ||  ||||           |||| | ||||||  c
3' cuc       uauuuuuc cuu uua       auccucgagggaa uc  guuu           ccua c gagaag  a
      ccacucc        u   c   -------             g  ag    -----------    - u      uu 
Get sequence
Deep sequencing
47364 reads, 1.64e+04 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00188: 92741-92885 [-]
intergenic
Database links

Mature sequence atr-miR319e

Accession MIMAT0033932
Sequence

98 - 

uuuggacugaagggagcuccu

 - 118

Get sequence
Deep sequencing47357 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).