Stem-loop sequence atr-MIR390

AccessionMI0027531 (change log)
DescriptionAmborella trichopoda miR390 stem-loop
Gene family MIPF0000101; MIR390
Stem-loop
        -aucaa   aa   uu     u g             g            -uuu  a     caua 
5' gugaa      aga  gcg  gagaa c guaaagcucagga ggauagcgccuc    uu aucug    u
   |||||      |||  |||  ||||| | ||||||||||||| ||||||||||||    || |||||    a
3' uacuu      ucu  cgu  cucuu g cauuuugaguccu ucuaucgcggag    aa uagac    u
        ccaaug   --   uc     u g             a            uugu  c     ucaa 
Get sequence
Deep sequencing
2526 reads, 2e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00023: 136000-136140 [+]
intergenic
Database links

Mature sequence atr-miR390.1

Accession MIMAT0033933
Sequence

30 - 

uaaagcucaggagggauagcg

 - 50

Get sequence
Deep sequencing1887 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence atr-miR390.2

Accession MIMAT0033934
Sequence

32 - 

aagcucaggagggauagcgcc

 - 52

Get sequence
Deep sequencing1887 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).