Stem-loop sequence atr-MIR393

AccessionMI0027532 (change log)
DescriptionAmborella trichopoda miR393 stem-loop
Gene family MIPF0000083; MIR393
Stem-loop
       gg     uu  aaaagcg     ga  uag     --   -g     ggg      -g          a    a            u       uucagu  a 
5' uuac  uggag  ac       guuuu  uc   uaaga  agc  gauuu   guugca  aggguggaga aucc aagggaucgcau gauccuu      gc a
   ||||  |||||  ||       |||||  ||   |||||  |||  |||||   ||||||  |||||||||| |||| |||||||||||| |||||||      || g
3' agug  acuuu  ug       cagaa  ag   guucu  ucg  uuaaa   uaacgu  uucuaccucu uagg uucucuggcgua cuaggaa      ug c
       -g     gg  gaaguua     -a  --u     cc   ag     --a      aa          g    a            -       -ccuuu  g 
Get sequence
Deep sequencing
952 reads, 550 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00009: 6768942-6769146 [+]
intergenic
Database links

Mature sequence atr-miR393

Accession MIMAT0033935
Sequence

71 - 

uccaaagggaucgcauugaucc

 - 92

Get sequence
Deep sequencing906 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).