Stem-loop sequence atr-MIR394

AccessionMI0027533 (change log)
DescriptionAmborella trichopoda miR394 stem-loop
Gene family MIPF0000100; MIR394
Stem-loop
   u    --            au  a     uu  ug     -auu       uuc             ccucucucuaaaaaaugaga 
5'  uugu  uugcauggguuu  ca agggu  cu  cagag    guuggca   uguccaccuccuc                    g
    ||||  ||||||||||||  || |||||  ||  |||||    |||||||   |||||||||||||                    u
3'  gacg  aacguacucaaa  gu ucuca  gg  gucuc    caaccgu   acggguggaggag                    u
   g    uu            au  c     uc  gu     acac       ccu             ugcuacguaauuuuagcuuu 
Get sequence
Deep sequencing
1646 reads, 675 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00001: 3120973-3121146 [+]
intergenic
Database links

Mature sequence atr-miR394

Accession MIMAT0033936
Sequence

43 - 

uuggcauucuguccaccucc

 - 62

Get sequence
Deep sequencing1601 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).