Stem-loop sequence atr-MIR395

AccessionMI0027534 (change log)
DescriptionAmborella trichopoda miR395 stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   -gc      a   c  ua            c c        a  u        -   -u   ag  -ag   g 
5'    auuggg gac cc  gaguucccucaa c cuucagcg ug gcucucuc cua  aca  ag   aga a
      |||||| ||| ||  |||||||||||| | |||||||| || |||||||| |||  |||  ||   ||| g
3'    uaacuc cug gg  cucaaggggguu g gaagucgc au ugagagag ggu  ugu  uc   uuu a
   uga      a   a  uc            u u        -  u        a   uu   gg  gua   g 
Get sequence
Deep sequencing
457 reads, 1.28e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00060: 2574005-2574148 [+]
intergenic
Database links

Mature sequence atr-miR395

Accession MIMAT0033937
Sequence

106 - 

cugaaguguuugggggaacuc

 - 126

Get sequence
Deep sequencing401 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).