Stem-loop sequence atr-MIR396e

AccessionMI0027539 (change log)
DescriptionAmborella trichopoda miR396e stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention atr-MIR396e
(1 sentences)

Stem-loop
   u         -           u  u  c   -   au  a     ga  ac 
5'  uuuccacag cuuucuugaac ug ua uca aca  gc ucucc  ga  c
    ||||||||| ||||||||||| || || ||| |||  || |||||  ||   
3'  aaagguguc gaaagaacuug ac au agu ugu  cg ggagg  cu  a
   g         c           u  c  a   c   -c  -     ag  ca 
Get sequence
Deep sequencing
360512 reads, 1.28e+05 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold02939: 2915-3016 [+]
intergenic
Database links

Mature sequence atr-miR396e

Accession MIMAT0033942
Sequence

3 - 

uuccacagcuuucuugaacuu

 - 23

Get sequence
Deep sequencing360476 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).