Stem-loop sequence atr-MIR397a

AccessionMI0027540 (change log)
DescriptionAmborella trichopoda miR397a stem-loop
Gene family MIPF0000120; MIR397
Stem-loop
   aaccaauuucaugcuugaggaggcccaaugggga    a    uaca    c               a    cccaaa 
5'                                   gaaa acca    cauc uugagugcagcguug ugaa      a
                                     |||| ||||    |||| ||||||||||||||| ||||       
3'                                   cuuu uggu    guag aacucaugucgcgac acuu      c
   --uugguuuuuuuccuuauucucuuuuuaaugua    a    uucc    u               g    uaaucc 
Get sequence
Deep sequencing
4168 reads, 3.1e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00016: 5120337-5120492 [-]
intergenic
Database links

Mature sequence atr-miR397a

Accession MIMAT0033943
Sequence

50 - 

uccuugagugcagcguugaug

 - 70

Get sequence
Deep sequencing3782 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).