Stem-loop sequence atr-MIR397b

AccessionMI0027541 (change log)
DescriptionAmborella trichopoda miR397b stem-loop
Gene family MIPF0000120; MIR397
Stem-loop
        -aa      aa   c    a           g    c      accuaauuu 
5' gagga   accaga  cau auug gugcagcguug ugaa cccaaa         u
   |||||   ||||||  ||| |||| ||||||||||| |||| ||||||         c
3' cuccu   ugguuu  gua uaac cacgucgcgac gcuu ggguuu         a
        aua      cc   u    c           g    u      guucucucu 
Get sequence
Deep sequencing
4136 reads, 2.62e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00072: 1231145-1231260 [+]
intergenic
Database links

Mature sequence atr-miR397b

Accession MIMAT0033944
Sequence

18 - 

ucauugagugcagcguuggug

 - 38

Get sequence
Deep sequencing4090 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).