Stem-loop sequence atr-MIR398

AccessionMI0027542 (change log)
DescriptionAmborella trichopoda miR398 stem-loop
Gene family MIPF0000107; MIR398
Stem-loop
      -c   auuc      ---gcauc   -     ga  u   aa    a     a  a         aucauaugcauaaauauuguguaugugu 
5' agc  caa    gaagaa        aga auggg  ag cuc  cagg gcgau ug gaacacaca                            g
   |||  |||    ||||||        ||| |||||  || |||  |||| ||||| || |||||||||                            u
3' ucg  guu    cuucuu        ucu uaccc  uc gag  gucc cgcug ac cuugugugu                            g
      uc   ----      aauaaaua   a     -g  c   cc    c     g  c         ucgugcguguacguguacgugugcacgu 
Get sequence
Deep sequencing
26021 reads, 2.75e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00102: 1169815-1169999 [+]
intergenic
Database links

Mature sequence atr-miR398

Accession MIMAT0033945
Sequence

125 - 

uguguucccaggucgccccug

 - 145

Get sequence
Deep sequencing22116 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).