Stem-loop sequence atr-MIR477

AccessionMI0027543 (change log)
DescriptionAmborella trichopoda miR477 stem-loop
Gene family MIPF0000216; MIR477
Stem-loop
       au   -u  agau       gag    --aa  aaaauu            a c            ca          g     --    u 
5' cuag  cua  gc    gggagua   gacc    ga      ucagggcaccua u uucacucucccu  agggcuucug uccuu  acca u
   ||||  |||  ||    |||||||   ||||    ||      |||||||||||| | ||||||||||||  |||||||||| |||||  ||||  
3' gauu  ggu  cg    ccuucau   uugg    cu      gguuuuguggau g aggugagagggg  uuccggagau aggag  uggu c
       cc   uc  --au       --a    cuaa  aucuuu            c u            -a          a     aa    a 
Get sequence
Deep sequencing
344 reads, 425 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00003: 709668-709849 [+]
intergenic
Database links

Mature sequence atr-miR477

Accession MIMAT0033946
Sequence

107 - 

agaggccuuaggggagagugg

 - 127

Get sequence
Deep sequencing198 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).