Stem-loop sequence atr-MIR828

AccessionMI0027545 (change log)
DescriptionAmborella trichopoda miR828 stem-loop
Gene family MIPF0000544; MIR828
Stem-loop
       uc  ac   a   u      c          uc  aucu    -    --u     -caua  a 
5' cucc  ug  uaa guu cuugcu aaaugaguau  ca    gcuu ucuc   cccua     ca g
   ||||  ||  ||| ||| |||||| ||||||||||  ||    |||| ||||   |||||     ||  
3' gagg  ac  auu caa gaacga uuuacucaua  gu    cggg agag   ggggu     gu c
       uc  --   c   c      c          gu  --cu    u    uac     uuuua  u 
Get sequence
Deep sequencing
128 reads, 1.35e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00009: 8165619-8165748 [+]
intergenic
Database links

Mature sequence atr-miR828

Accession MIMAT0033948
Sequence

96 - 

ugauacucauuucagcaagcaa

 - 117

Get sequence
Deep sequencing51 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).