Stem-loop sequence atr-MIR8558b

AccessionMI0027546 (change log)
DescriptionAmborella trichopoda miR8558b stem-loop
Stem-loop
        a   g   ucuu  a  --   ag   -au     aaug         c  u    u      u          -     a aau         cuaguuuugguuuuuacgggaaaccaggauuaggaaacucuaauuuuggcuc 
5' gugcg agg ggc    gc gg  cgg  gac   ggugg    gugaagagg gg augg agccgu gguguauggc ugggc g   uuggaaacc                                                    u
   ||||| ||| |||    || ||  |||  |||   |||||    ||||||||| || |||| |||||| |||||||||| ||||| |   |||||||||                                                    u
3' cacgc uuu ccg    cg cc  gcc  uug   ucacc    uacuuuucc cc uauc ucggua ccaugugccg acccg c   agccuuugg                                                    a
        a   g   uucc  c  ua   cu   aau     -caa         -  -    u      c          u     c -cu         uaccaaaggacauucuguggguuuaauccaagaggauuaugaccuaaaggcc 
Get sequence
Deep sequencing
28427 reads, 1.95e+04 reads per million, 4 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00017: 2879753-2880049 [+]
intergenic
Database links

Mature sequence atr-miR8558b

Accession MIMAT0033949
Sequence

205 - 

uuuccgaucccgcccaugccgu

 - 226

Get sequence
Deep sequencing22862 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).