Stem-loop sequence atr-MIR8615

AccessionMI0027547 (change log)
DescriptionAmborella trichopoda miR8615 stem-loop
Stem-loop
     u  -    auucacaacuaca                   a               a a  -----aa     ug      auuagcg  g  g  caa 
5' gc cg cgaa             acgaauggcguuugugcgu gaaucauaccugcaa g ca       accuc  ggaggu       cc ug ga   u
   || || ||||             ||||||||||||||||||| ||||||||||||||| | ||       |||||  ||||||       || || ||    
3' cg gc guuu             ugcuuaccgcaagcacgca cuuaguauggauguu c gu       uggag  ucucca       gg ac uu   a
     -  a    -------------                   c               c a  acaaaga     gu      --gaaca  a  g  ucc 
Get sequence
Deep sequencing
9876 reads, 8.4e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00069: 1966180-1966361 [-]
intergenic
Database links

Mature sequence atr-miR8615

Accession MIMAT0033950
Sequence

138 - 

cuuguagguaugauuccacgca

 - 159

Get sequence
Deep sequencing1359 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).