Stem-loop sequence atr-MIR2950

AccessionMI0027548 (change log)
DescriptionAmborella trichopoda miR2950 stem-loop
Stem-loop
   uu   g u                   ug a     -  u 
5'   gug u uauuccaucucuugcacac  g ccagu gc u
     ||| | |||||||||||||||||||  | ||||| ||  
3'   cac g auaaggugggggacgugug  u gguca cg c
   cc   g u                   gu -     a  a 
Get sequence
Deep sequencing
2598 reads, 4.88e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (AmTr_v1.0) Overlapping transcripts
scaffold00059: 4206332-4206411 [-]
intergenic
Database links

Mature sequence atr-miR2950

Accession MIMAT0033951
Sequence

11 - 

uuccaucucuugcacacugga

 - 31

Get sequence
Deep sequencing2585 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24357323 "The Amborella genome and the evolution of flowering plants" Amborella Genome Project Science. 342:1241089(2013).