Stem-loop sequence esi-MIR8620

AccessionMI0027552 (change log)
DescriptionEctocarpus siliculosus miR8620 stem-loop
                                                                      --    ac     aaggaucugccugucuaacaacgucgug 
5' gcggcagcggcugcaggaacggcggcggccggcgagggcgccgcggugaccgaagagcccccuccgc  gccg  accgg                            u
   |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||  |||||                             
3' cgccgucgccgacguccuugccgccgccggccgcucccgcggcgccacuggcuucucggggggggcg  cggc  uggcc                            g
                                                                      ac    ca     gcggccgugccgccacgccgccaacuag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_209: 28542-28757 [-]
Database links

Mature sequence esi-miR8620

Accession MIMAT0033955

199 - 


 - 216

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).