Stem-loop sequence esi-MIR8621

AccessionMI0027553 (change log)
DescriptionEctocarpus siliculosus miR8621 stem-loop
                             u   cua    -a   ag   ag     a            c                           
5' acuucgccgccggcgcaguugccguc gcu   guga  cuc  ucc  gaugg aacgccucuaug ugcgcuccgugggguacagccuguac 
   |||||||||||||||||||||||||| |||   ||||  |||  |||  ||||| |||||||||||| ||||||||||||||||||||||||| c
3' ugaagcggcggucgugucgacggcag cga   cacu  gag  agg  cugcc uugcggagauac acgcgaggcaccccauguuggacaug 
                             -   cac    gg   ca   -a     c            a                           
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_414: 84877-85062 [-]
Database links

Mature sequence esi-miR8621

Accession MIMAT0033956

1 - 


 - 18

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).