Stem-loop sequence esi-MIR8623c

AccessionMI0027555 (change log)
DescriptionEctocarpus siliculosus miR8623c stem-loop
Gene family MIPF0001961; MIR8623
Stem-loop
                g  cug      u   -acg          u u -         a   ag   c   c     u 
5' gucccaugggaca cc   gggacg ccc    ugucucaugg g c ccaugggac gcu  ggc guc caugg g
   ||||||||||||| ||   |||||| |||    |||||||||| | | ||||||||| |||  ||| ||| |||||  
3' caggguacccugu gg   cccugc ggg    acagaguacc c g gguacccug cgg  ucg cag guacc u
                -  -ua      c   auag          - u u         c   ga   a   a     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_458: 10230-10380 [-]
intergenic
Database links

Mature sequence esi-miR8623c

Accession MIMAT0033958
Sequence

130 - 

gucccauggugucccaugggac

 - 151

Get sequence
Evidence experimental; qPCR [1]

References

1
PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).