Stem-loop sequence esi-MIR8622b

AccessionMI0027556 (change log)
DescriptionEctocarpus siliculosus miR8622b stem-loop
Gene family MIPF0001931; MIR8622
                            c     a        a           a c     g   ag   a c       --g     gu           auuag 
5' cgaaaucugcgccggaaccaagcgg aucca cauuuguc cagccgugcuc c gccac gac  uaa c ccugaac   ggguu  caguaguagcu     u
   ||||||||||||||||||||||||| ||||| |||||||| ||||||||||| | ||||| |||  ||| | |||||||   |||||  |||||||||||      
3' gcuuuagacgcggccuugguucgcc uaggu guaaacag gucggcacgag g cggug cug  guu g ggacuug   cccaa  gucgucaucga     g
                            a     a        c           c a     a   gg   a a       aca     au           cuacg 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_0: 3431161-3431370 [+]
Database links

Mature sequence esi-miR8622b

Accession MIMAT0033959

189 - 


 - 210

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).