Stem-loop sequence esi-MIR8624a

AccessionMI0027558 (change log)
DescriptionEctocarpus siliculosus miR8624a stem-loop
Gene family MIPF0002113; MIR8624
                                    c                                 a   -       ug     aa   au    -     auu      aa 
5' acacacugauucucggaagcuaucaacuuugcu guccucgaugaauugguccugauaugugcguga cgu uuuuugg  gaagc  gag  uugg gucug   cggcug  g
   ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||  |||||  |||  |||| |||||   ||||||   
3' ugugugacuaagagccuucgauaguugaaacga caggagcuacuuaaccagggcuauacacgcacu gca aaaagcu  uuucg  cuu  aacc cggac   gccggc  a
                                    a                                 c   c       --     aa   -c    u     ---      ca 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_22: 195915-196136 [-]
Database links

Mature sequence esi-miR8624a

Accession MIMAT0033961

194 - 


 - 218

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).