Stem-loop sequence esi-MIR8626

AccessionMI0027561 (change log)
DescriptionEctocarpus siliculosus miR8626 stem-loop
Stem-loop
          gca        cgcgucauggagagacgcgaccccgucggcg 
5' ggcguca   gccgccgc                               c
   |||||||   ||||||||                                
3' cugcggu   cggcggcg                               c
          -ag        gggggggcgcggaccuguaggacuggucaga 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_221: 252228-252326 [-]
intergenic
Database links

Mature sequence esi-miR8626

Accession MIMAT0033964
Sequence

4 - 

gucagcagccgccgccgc

 - 21

Get sequence
Evidence experimental; qPCR [1]

References

1
PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).