Stem-loop sequence esi-MIR8629

AccessionMI0027564 (change log)
DescriptionEctocarpus siliculosus miR8629 stem-loop
   ------------------ugaagcuaaauaguggugacugcuguggggucuaugau                a                  ca ga   g                 g u 
5'                                                         ugcgagcaaaaguaag auccguauggagaauccg  g  gau cuauacgauaguuuggc a a
                                                           |||||||||||||||| ||||||||||||||||||  |  ||| ||||||||||||||||| | g
3'                                                         acgcucguuuucauuu uaggcauaccucuugggc  c  cua gauaugcuaucaaaccg u u
   aacuucgaucaccacugacgacaccccagacacacacgacucuucuacaguuaggu                a                  ag uc   a                 g u 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_300: 159636-159860 [+]
Database links

Mature sequence esi-miR8629

Accession MIMAT0033967

201 - 


 - 225

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).