Stem-loop sequence esi-MIR8631

AccessionMI0027567 (change log)
DescriptionEctocarpus siliculosus miR8631 stem-loop
                   c       -----     ---   uuccgugagaagucgcgguagcgc 
5' gguuaacauggucccc gacucua     auuca   ugc                        c
   |||||||||||||||| |||||||     |||||   |||                        u
3' ccaauuguaucagggg cugagau     uaagu   acg                        c
                   u       guuca     ugc   aucgacggaggcgcggaaaggugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EctsiV2) Overlapping transcripts
sctg_144: 348677-348799 [-]
Database links

Mature sequence esi-miR8631

Accession MIMAT0033970

104 - 


 - 123

Get sequence
Evidence experimental; qPCR [1]


PMID:24078085 "Computational prediction and experimental validation of microRNAs in the brown alga Ectocarpus siliculosus" Billoud B, Nehr Z, Le Bail A, Charrier B Nucleic Acids Res. 42:417-429(2014).