Stem-loop sequence sly-MIR164b

AccessionMI0027571 (change log)
DescriptionSolanum lycopersicum miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

18 open access papers mention sly-MIR164b
(111 sentences)

Stem-loop
             c              uucuuguauucgacaauauaug 
5' guuggagaag agggcacgugcaaa                      c
   |||||||||| ||||||||||||||                       
3' caaccucuuc ucuugugcacguuu                      a
             c              uaaguacguaaugguaaucauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SL2.50; GCA_000188115.2) Overlapping transcripts
chr1: 89971259-89971354 [+]
intergenic
Database links

Mature sequence sly-miR164b-5p

Accession MIMAT0033975
Sequence

3 - 

uggagaagcagggcacgugca

 - 23

Get sequence
Evidence experimental; Northern [1]

Mature sequence sly-miR164b-3p

Accession MIMAT0033976
Sequence

76 - 

cacguguucuccuucuccaac

 - 96

Get sequence
Evidence experimental; Northern [1]

References

1
PMID:24085581 "The tomato NAC transcription factor SlNAM2 is involved in flower-boundary morphogenesis" Hendelman A, Stav R, Zemach H, Arazi T J Exp Bot. 64:5497-5507(2013).