Stem-loop sequence gra-MIR8653a

AccessionMI0027607 (change log)
DescriptionGossypium raimondii miR8653a stem-loop
Gene family MIPF0002011; MIR8653
Stem-loop
   -               c         a      g   c         g                          u                             a                       a            ua                   ca 
5'  acaaucgugguaaau uacguaugg aauucu uga acuggaucc cuauuacacuggccguaaaauaaguu gaauaauuuugagguguuccaaggggaug gauggucucggccuuccauaaca guauacaucucc  gaguaguagaacauuaguu  c
    ||||||||||||||| ||||||||| |||||| ||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||  |||||||||||||||||||  g
3'  uguuagcaccauuua augcauacc uuaaga acu ugaccuagg gauaaugugaccggcauuuuauucaa cuuguuaaaacuccacaagguuccucuac cuaccagaguuggaagguauugu uauauguagagg  cucaucaucuuguaaucaa  a
   c               c         c      g   a         a                          -                             c                       a            gc                   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr11: 60619123-60619451 [+]
intergenic
Clustered miRNAs
< 10kb from gra-MIR8653a
gra-MIR8653achr11: 60619123-60619451 [+]
gra-MIR8653bchr11: 60619169-60619404 [-]
gra-MIR8749chr11: 60620749-60621059 [+]
Database links

Mature sequence gra-miR8653a

Accession MIMAT0034012
Sequence

11 - 

uaaaucuacguauggaaauuc

 - 31

Get sequence
Evidence experimental; Illumina [1]

References

1