Stem-loop sequence gra-MIR8653b

AccessionMI0027796 (change log)
DescriptionGossypium raimondii miR8653b stem-loop
Gene family MIPF0002011; MIR8653
Stem-loop
   u                          -   c                    a              aa            ua           cg                   gu 
5'  cuauuacacuggccguaaaauaaguu gaa aauuuugagguguuccaagg gaugggauggucuc  ccuuccauaaca  uauacaucucc  gaguaguagaacauuaguu  u
    |||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||||||  ||||||||||||  |||||||||||  |||||||||||||||||||  c
3'  gauaaugugaccggcauuuuauucaa cuu uuaaaacuccacaagguucc cuacucuaccagag  ggaagguauugu  auauguagagg  cucaucaucuuguaaucaa  g
   c                          a   a                    c              cc            uc           au                   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Graimondii2_0; GCA_000327365.1) Overlapping transcripts
chr11: 60619169-60619404 [-]
intergenic
Clustered miRNAs
< 10kb from gra-MIR8653b
gra-MIR8749chr11: 60620749-60621059 [+]
gra-MIR8653bchr11: 60619169-60619404 [-]
gra-MIR8653achr11: 60619123-60619451 [+]
Database links

Mature sequence gra-miR8653b

Accession MIMAT0034201
Sequence

206 - 

uucaaacuuauuuuacggcca

 - 226

Get sequence
Evidence experimental; Illumina [1]

References

1