Stem-loop sequence cfa-let-7d

AccessionMI0027994 (change log)
DescriptionCanis familiaris let-7d stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   --------------------a      uu       a              c      uuagggcagggauu 
5'                      aauggg  ccuagga gagguaguagguug auaguu              u
                        ||||||  ||||||| |||||||||||||| ||||||               
3'                      uuauuc  ggauucu uuccgucguccagc uaucaa              u
   uucucguccaauggcaccuca      cg       -              a      uggaggaacacccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr1: 97902012-97902136 [-]
intergenic
Clustered miRNAs
< 10kb from cfa-let-7d
cfa-let-7fchr1: 97903931-97904008 [-]
cfa-let-7dchr1: 97902012-97902136 [-]
Database links

Mature sequence cfa-let-7d

Accession MIMAT0034396
Sequence

71 - 

cuauacgaccugcugccuuucuuag

 - 95

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).