Stem-loop sequence efu-mir-128a

AccessionMI0028607
DescriptionEptesicus fuscus miR-128a stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   cg     -ag    gc  ccac    ---       a          aug      ac    g gag 
5'   gccgg   cccg  ag    ugug   caguggg aggggggccg   cacugu  gaga u   u
     |||||   ||||  ||    ||||   ||||||| ||||||||||   ||||||  |||| |    
3'   cggcc   gggc  uc    acac   gucaucc uuucucuggc   gugaca  cucu g   a
   cg     gua    aa  -cuc    ugu       c          caa      --    g acg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0) Overlapping transcripts
JH977614.1: 29773447-29773575 [+]
intergenic

Mature sequence efu-miR-128a

Accession MIMAT0034922
Sequence

73 - 

ucacagugaaccggucucuuuc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large Numbers of Novel miRNAs Originate from DNA Transposons and Are Coincident with a Large Species Radiation in Bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. [Epub prior to print](2014).