Stem-loop sequence efu-mir-128a

AccessionMI0028607 (change log)
DescriptionEptesicus fuscus miR-128a stem-loop
Gene family MIPF0000048; mir-128
Stem-loop
   --        a          aug      ac    g gag 
5'   gcaguggg aggggggccg   cacugu  gaga u   u
     |||||||| ||||||||||   ||||||  |||| |    
3'   ugucaucc uuucucuggc   gugaca  cucu g   a
   ug        c          caa      --    g acg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977614.1: 29773471-29773550 [+]
intergenic
Database links

Mature sequence efu-miR-128a

Accession MIMAT0034922
Sequence

49 - 

ucacagugaaccggucucuuuc

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).