Stem-loop sequence efu-let-7c

AccessionMI0028628 (change log)
DescriptionEptesicus fuscus let-7c stem-loop
Gene family MIPF0000002; let-7
Stem-loop
   ---    a      uu   g   u             ------   a u 
5'    gugc uccggg  gag uag agguuguaugguu      uag g u
      |||| ||||||  ||| ||| |||||||||||||      ||| | a
3'    cacg agguuc  uuc auc uccaacaugucaa      guc c u
   uca    -      cu   g   u             uugagg   c a 
Get sequence
Deep sequencing
1 reads, 1.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977643.1: 519414-519504 [+]
intergenic
Clustered miRNAs
< 10kb from efu-let-7c
efu-mir-99aJH977643.1: 518687-518767 [+]
efu-let-7cJH977643.1: 519414-519504 [+]
Database links

Mature sequence efu-let-7c

Accession MIMAT0034943
Sequence

11 - 

guugagguaguagguuguaugguuu

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).