Stem-loop sequence efu-mir-99a

AccessionMI0028629 (change log)
DescriptionEptesicus fuscus miR-99a stem-loop
Gene family MIPF0000033; mir-10
Stem-loop
   --c          a         uc   u      g  aag 
5'    cauuggcaua acccguaga  cga cuugug ug   u
      |||||||||| |||||||||  ||| |||||| ||    
3'    gugacugugu uggguaucu  gcu gaacac gc   g
   ggu          c         uc   c      -  cag 
Get sequence
Deep sequencing
1 reads, 1.3e+03 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977643.1: 518687-518767 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-99a
efu-mir-99aJH977643.1: 518687-518767 [+]
efu-let-7cJH977643.1: 519414-519504 [+]
Database links

Mature sequence efu-miR-99a

Accession MIMAT0034944
Sequence

11 - 

aaacccguagauccgaucuuguggu

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).